miR-145-5p inhibits proliferation, invasion and SOX9/β-catenin expression of adamantinomatous craniopharyngioma cells

doi:10.3877/cma.j.issn.2095-9141.2024.01.002

Abstract

Abstract:

Objective

To investigate the effects of miR-145-5p on the proliferation, invasion, and apoptosis of adamantinomatous craniopharyngioma (aCP) cells and its mechanism of action.

Methods

Five cases of aCP and five cases of papillary craniopharyngioma (pCP) resected at Neurosurgery Department of West China Hospital of Sichuan University and Guangyuan Central Hospital from September 2019 to September 2022 were selected. The expression differences of miR-145-5p, SOX9, and CTNNB1 (β-catenin gene) mRNA in aCP and pCP were detected by real-time fluorescence quantitative PCR (qRT-PCR). The expression of SOX9 and β-catenin proteins were detected by immunofluorescence and Western blot. The proliferation, invasion, and apoptosis levels of craniopharyngioma cells were measured through CCK8 assay, Transwell chamber, and flow cytometry, respectively. aCP cells were divided into aCP group (blank control, untransfected), aCP+miR-145-5p control group (negative control), and aCP+miR-145-5p mimic group (overexpression) to study the effects of miR-145-5p on the proliferation, invasion, and apoptosis of aCP cells and on the expression of SOX9 and β-catenin.

Results

Compared with pCP, aCP cells showed significantly reduced expression of miR-145-5p mRNA and increased expression of SOX9、CTNNB1 mRNA, SOX9、nuclear β-catenin proteins, and a decreased in cytoplasmic β-catenin protein expression, concurrently, cell proliferation and invasion were significantly enhanced, with all differences being statistically significant (P<0.05). There were differences among the aCP group, aCP+miR-145-5p control group, and aCP+miR-145-5p mimic group in terms of miR-145-5p, SOX9, and CTNNB1 mRNA expression, as well as SOX9, nuclear β-catenin, and cytoplasmic β-catenin protein expression, and in cell proliferation and invasion (P<0.05). Pairwise comparisons between groups showed that the aCP+miR-145-5p mimic group had significantly increased expression of miR-145-5p mRNA, weakened proliferation and invasion, and increased apoptosis compared to the other two groups. The expression of SOX9 and CTNNB1 mRNA was significantly reduced. Compared to the aCP+miR-145-5p control group, the expression of SOX9 and nuclear β-catenin proteins decreased, while cytoplasmic β-catenin protein expression increased in the aCP+miR-145-5p mimic group, with all differences being statistically significant (P<0.05).

Conclusion

miR-145-5p may inhibit the proliferation、invasion of aCP and promote cell apoptosis by down-regulating the SOX9 and β-catenin.

Key words: Adamantinomatous craniopharyngioma, Papillary craniopharyngioma, miR-145-5p, SOX9, β-catenin, Proliferation, Invasion, Apoptosis

Keshun Xia, Yaohui Huang, Mao Wang, Zhiyong Liu, Bo Tan, Peng Song, Xiaohong Yin. miR-145-5p inhibits proliferation, invasion and SOX9/β-catenin expression of adamantinomatous craniopharyngioma cells[J]. Chinese Journal of Neurotraumatic Surgery(Electronic Edition), 2024, 10(01): 6-15.

/ / Recommend

Add to citation manager EndNote|Ris|BibTeX

URL: https://zhsjcswkdzzz.cma-cmc.com.cn/EN/10.3877/cma.j.issn.2095-9141.2024.01.002

https://zhsjcswkdzzz.cma-cmc.com.cn/EN/Y2024/V10/I01/6

Figures/Tables 12

Tab.1 Primer sequences for qRT-PCR

名称	引物方向	序列（5’-3’）
miR-145-5p	正向	TGCGCGTCCAGTTTTCCCAGGAA
miR-145-5p	反向	CCAGTGCAGGGTCCGAGGTATT
U6	正向	CGCTTCGGCAGCACATATAC
U6	反向	AAATATGGAACGCTTCACGA
SOX9	正向	ATGAAGATGACCGACGAGCA
SOX9	反向	CAGTCGTAGCCTTTGAGCAC
CTNNB1	正向	CCAAGTGGGTGGTATAGAGG
CTNNB1	反向	AGTCCATAGTGAAGGCGAAC
GAPDH	正向	TCAAGAAGGTGGTGAAGCAGG
GAPDH	反向	TCAAAGGTGGAGGAGTGGGT

Fig.1 pan-CK expression in primary cells of aCP and pCP (×400)

Fig.2 The invasion ability of aCP and pCP primary cells was detected by Transwell assay（×200）

Fig.3 Immunofluorescence detect the expression of SOX9 and β-catenin in aCP and pCP primary cells (×200)

Fig.4 Western blot detect the expression of SOX9 and β-catenin in aCP and pCP primary cells

Tab.2 Expressions of miR-145-5p, SOX9 and CTNNB1 in aCP and pCP cells detected by qRT-PCR (Mean±SD)

名称	aCP	pCP	t值	P值
miR-145-5p	0.65±0.07	1.00±0.19	-3.865	0.012
SOX9	2.75±0.26	1.00±0.18	12.374	<0.001
CTNNB1	2.22±0.31	1.00±0.10	8.207	<0.001

Fig.5 Transwell assay detect the effect of miR-145-5p on invasive ability of aCP cells（×400)

Fig.6 Flow cytometry detect the effect of miR-145-5p on apoptosis of aCP cells

Tab.3 Effects of miR-145-5p on proliferation, invasion and apoptosis of aCP cells（Mean±SD）

组别	转染后miR-145-5p表达	CCK8增殖	Transwell侵袭	流式凋亡
aCP组	1.00±0.11	100.00±7.22	157.40±13.58	3.72±0.79
aCP+miR-145-5p control组	0.92±0.18	95.98±8.06	164.60±12.82	6.87±2.17
aCP+miR-145-5p mimic组	7.10±0.75^ab	79.92±4.68^ab	103.40±6.43^ab	24.95±2.44 ^ab
F值	301.432	12.187	43.045	174.106
P值	<0.001	0.001	<0.001	<0.001

Fig.7 Immunofluorescence detect the effect of miR-145-5p on the expression of SOX9 and β-catenin in aCP cells (×400)

Fig.8 Western blot detect the effect of miR-145-5p on the expression of SOX9 and β-catenin protein in aCP cells

Tab.4 Effect of miR-145-5p on the expression of SOX9 and CTNNB1 mRNA in aCP cells

组别	SOX9	CTNNB1
aCP组	1.00±0.15	1.00±0.09
aCP+miR-145-5p control组	1.01±0.10	1.09±0.14
aCP+miR-145-5p mimic组	0.61±0.08^ab	0.68±0.11^ab
F值	12.191	17.444
P值	0.001	<0.001

References 38

[1]	Louis DN, Perry A, Reifenberger G, et al. The 2016 world health organization classification of tumors of the central nervous system: a summary[J]. Acta Neuropathol, 2016, 131(6): 803-820. DOI: 10.1007/s00401-016-1545-1.
[2]	Zacharia BE, Bruce SS, Goldstein H, et al. Incidence, treatment and survival of patients with craniopharyngioma in the surveillance, epidemiology and end results program[J]. Neuro Oncol, 2012, 14(8): 1070-1078. DOI: 10.1093/neuonc/nos142.
[3]	Momin AA, Recinos MA, Cioffi G, et al. Descriptive epidemiology of craniopharyngiomas in the United States[J]. Pituitary, 2021, 24(4): 517-522. DOI: 10.1007/s11102-021-01127-6.
[4]	Otte A, Müller HL. Childhood-onset craniopharyngioma[J]. J Clin Endocrinol Metab, 2021, 106(10): e3820-e3836. DOI: 10.1210/clinem/dgab397.
[5]	Mallucci C, Pizer B, Blair J, et al. Management of craniopharyngioma: the Liverpool experience following the introduction of the CCLG guidelines. Introducing a new risk assessment grading system[J]. Childs Nerv Syst, 2012, 28(8): 1181-1192. DOI: 10.1007/s00381-012-1787-8.
[6]	Puget S, Garnett M, Wray A, et al. Pediatric craniopharyngiomas: classification and treatment according to the degree of hypothalamic involvement[J]. J Neurosurg, 2007, 106(1 Suppl): 3-12. DOI: 10.3171/ped.2007.106.1.3.
[7]	Park HJ, Dho YS, Kim JH, et al. Recurrence rate and prognostic factors for the adult craniopharyngiomas in long-term follow-up[J]. World Neurosurg, 2020, 133: e211-e217. DOI: 10.1016/j.wneu.2019.08.209.
[8]	Castro-Dufourny I, Carrasco R, Prieto R, et al. The first sixty-five craniopharyngioma operations in France[J]. Rev Neurol (Paris), 2017, 173(4): 180-188. DOI: 10.1016/j.neurol.2016.12.030.
[9]	Wu J, Wu X, Yang YQ, et al. Association of histological subtype with risk of recurrence in craniopharyngioma patients: a systematic review and meta-analysis[J]. Neurosurg Rev, 2022, 45(1): 139-150. DOI: 10.1007/s10143-021-01563-9.
[10]	Dong M, Xu T, Li H, et al. LINC00052 promotes breast cancer cell progression and metastasis by sponging miR-145-5p to modulate TGFBR2 expression[J]. Oncol Lett, 2021, 21(5): 368. DOI: 10.3892/ol.2021.12629.
[11]	Kadkhoda S, Ghafouri-Fard S. Function of miRNA-145-5p in the pathogenesis of human disorders[J]. Pathol Res Pract, 2022, 231: 153780. DOI: 10.1016/j.prp.2022.153780.
[12]	Chen J, Chen T, Zhu Y, et al. circPTN sponges miR-145-5p/miR-330-5p to promote proliferation and stemness in glioma[J]. J Exp Clin Cancer Res, 2019, 38(1): 398. DOI: 10.1186/s13046-019-1376-8.
[13]	Rani SB, Rathod SS, Karthik S, et al. MiR-145 functions as a tumor-suppressive RNA by targeting Sox9 and adducin 3 in human glioma cells[J]. Neuro Oncol, 2013, 15(10): 1302-1316. DOI: 10.1093/neuonc/not090.
[14]	Campanini ML, Colli LM, Paixao BM, et al. CTNNB1 gene mutations, pituitary transcription factors, and MicroRNA expression involvement in the pathogenesis of adamantinomatous craniopharyngiomas[J]. Horm Cancer, 2010, 1(4): 187-196. DOI: 10.1007/s12672-010-0041-7.
[15]	Chen S, Deng X, Sheng H, et al. Noncoding RNAs in pediatric brain tumors: molecular functions and pathological implications[J]. Mol Ther Nucleic Acids, 2021, 26417-431. DOI: 10.1016/j.omtn.2021.07.024.
[16]	Chang CV, Araujo RV, Cirqueira CS, et al. Differential expression of stem cell markers in human adamantinomatous craniopharyngioma and pituitary adenoma[J]. Neuroendocrinology, 2017, 104(2): 183-193. DOI: 10.1159/000446072.
[17]	Herranz H, Cohen SM. MicroRNAs and gene regulatory networks: managing the impact of noise in biological systems[J]. Genes Dev, 2010, 24(13): 1339-1344. DOI: 10.1101/gad.1937010.
[18]	Dragomir MP, Knutsen E, Calin GA. Classical and noncanonical functions of miRNAs in cancers[J]. Trends Genet, 2022, 38(4): 379-394. DOI: 10.1016/j.tig.2021.10.002.
[19]	Ye D, Shen Z, Zhou S. Function of microRNA-145 and mechanisms underlying its role in malignant tumor diagnosis and treatment[J]. Cancer Manag Res, 2019, 11: 969-979. DOI: 10.2147/cmar.S191696.
[20]	Wang J, Zhang H, Situ J, et al. KCNQ1OT1 aggravates cell proliferation and migration in bladder cancer through modulating miR-145-5p/PCBP2 axis[J]. Cancer Cell Int, 2019, 19: 325. DOI: 10.1186/s12935-019-1039-z.
[21]	Matsushita R, Yoshino H, Enokida H, et al. Regulation of UHRF1 by dual-strand tumor-suppressor microRNA-145 (miR-145-5p and miR-145-3p): inhibition of bladder cancer cell aggressiveness[J]. Oncotarget, 2016, 7(19): 28460-28487. DOI: 10.18632/oncotarget.8668.
[22]	Wu Z, Huang W, Wang X, et al. Circular RNA CEP128 acts as a sponge of miR-145-5p in promoting the bladder cancer progression via regulating SOX11[J]. Mol Med, 2018, 24(1): 40. DOI: 10.1186/s10020-018-0039-0.
[23]	Zhang L, Wang X, Li Y, et al. c-Myb facilitates immune escape of esophageal adenocarcinoma cells through the miR-145-5p/SPOP/PD-L1 axis[J]. Clin Transl Med, 2021, 11(9): e464. DOI: 10.1002/ctm2.464.
[24]	Lawson J, Dickman C, MacLellan S, et al. Selective secretion of microRNAs from lung cancer cells via extracellular vesicles promotes CAMK1D-mediated tube formation in endothelial cells[J]. Oncotarget, 2017, 8(48): 83913-83924. DOI: 10.18632/oncotarget.19996.
[25]	Panda M, Tripathi SK, Biswal BK. SOX9: an emerging driving factor from cancer progression to drug resistance[J]. Biochim Biophys Acta Rev Cancer, 2021, 1875(2): 188517. DOI: 10.1016/j.bbcan.2021.188517.
[26]	Andre F, Arnedos M, Baras AS, et al. AACR project GENIE: powering precision medicine through an international consortium[J]. Cancer Discov, 2017, 7(8): 818-831. DOI: 10.1158/2159-8290.Cd-17-0151.
[27]	Aleman A, Adrien L, Lopez-Serra L, et al. Identification of DNA hypermethylation of SOX9 in association with bladder cancer progression using CpG microarrays[J]. Br J Cancer, 2008, 98(2): 466-473. DOI: 10.1038/sj.bjc.6604143.
[28]	Passeron T, Valencia JC, Namiki T, et al. Upregulation of SOX9 inhibits the growth of human and mouse melanomas and restores their sensitivity to retinoic acid[J]. J Clin Invest, 2009, 119(4): 954-963. DOI: 10.1172/jci34015.
[29]	Wang HY, Lian P, Zheng PS. SOX9, a potential tumor suppressor in cervical cancer, transactivates p21WAF1/CIP1 and suppresses cervical tumor growth[J]. Oncotarget, 2015, 6(24): 20711-20722. DOI: 10.18632/oncotarget.4133.
[30]	Yu CC, Tsai LL, Wang ML, et al. miR145 targets the SOX9/ADAM17 axis to inhibit tumor-initiating cells and IL-6-mediated paracrine effects in head and neck cancer [J]. Cancer Res, 2013, 73(11): 3425-3440. DOI: 10.1158/0008-5472.Can-12-3840.
[31]	Li Y, Liu J, Piao J, et al. Circ_0109046 promotes the malignancy of endometrial carcinoma cells through the microRNA-105/SOX9/Wnt/β-catenin axis[J]. IUBMB Life, 2021, 73(1): 159-176. DOI: 10.1002/iub.2415.
[32]	Tian H, Hou L, Xiong Y, et al. Dexmedetomidine upregulates microRNA-185 to suppress ovarian cancer growth via inhibiting the SOX9/Wnt/β-catenin signaling pathway[J]. Cell Cycle, 2021, 20(8): 765-780. DOI: 10.1080/15384101.2021.1897270.
[33]	Ma F, Ye H, He HH, et al. SOX9 drives WNT pathway activation in prostate cancer[J]. J Clin Invest, 2016, 126(5): 1745-1758. DOI: 10.1172/jci78815.
[34]	Liu H, Liu Z, Jiang B, et al. Sox9 overexpression promotes glioma metastasis via wnt/β-catenin signaling[J]. Cell Biochem Biophys, 2015, 73(1): 205-212. DOI: 10.1007/s12013-015-0647-z.
[35]	Guo YZ, Xie XL, Fu J, et al. SOX9 regulated proliferation and apoptosis of human lung carcinoma cells by the Wnt/β-catenin signaling pathway [J]. Eur Rev Med Pharmacol Sci, 2018, 22(15): 4898-4907. DOI: 10.26355/eurrev_201808_15626.
[36]	Galera-Ruiz H, Ríos-Moreno MJ, González-Cámpora R, et al. WNT pathway in laryngeal squamous cell carcinoma and nasopharyngeal carcinoma[J]. Acta Otorhinolaryngol Ital, 2012, 32(2): 122-123.
[37]	Reyes M, Taghvaei M, Yu S, et al. Targeted therapy in the management of modern craniopharyngiomas[J]. Front Biosci (Landmark Ed), 2022, 27(4): 136. DOI: 10.31083/j.fbl2704136.
[38]	Zhao C, Wang Y, Liu H, et al. Molecular biological features of cyst wall of adamantinomatous craniopharyngioma[J]. Sci Rep, 2023, 13(1): 3049. DOI: 10.1038/s41598-023-29664-z.

Please choose a citation manager

Content to export